View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376_low_51 (Length: 336)
Name: NF3376_low_51
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376_low_51 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 11 - 296
Target Start/End: Original strand, 26960332 - 26960615
Alignment:
| Q |
11 |
agaatataagttagaaaaaatctctaaatattagtttctttt-atattattagattttttaacnnnnnnntgctcctaattaatttactgccttttttag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26960332 |
agaatataagttagaaaaaatctctaaatattagtttctttttatattattagattttttaacaaaaaaatgctcctaattaatttactgccttttttag |
26960431 |
T |
|
| Q |
110 |
aatcattgtttacctaaaagttgtttatatatgacttactactactctatttttattatagattat--gacttgctactctagttaatttattaaatgag |
207 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||| || || || |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26960432 |
aatcattgtttaactaaaatttgtttatatatgacttactact---ctcttctt--tatagattatatgacttgctactctagttaatttattaaatgag |
26960526 |
T |
|
| Q |
208 |
attgcttatttatcttgtaagggcatggcaaattggcaatcatgcgtatatttcattatttattttcttaaagaagaacatttctttcc |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
26960527 |
attgcttatttatcttgtaagggcatggcaaattggcaatcatgcgtatatttctttatttattttcttaaagaagaacatttctttcc |
26960615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University