View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376_low_67 (Length: 295)
Name: NF3376_low_67
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376_low_67 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 173 - 278
Target Start/End: Complemental strand, 44678375 - 44678270
Alignment:
| Q |
173 |
ggggtttgaaggtttgcttcgatgtggtaaaagttgtagattaagatggattaactatttgagagctgatctcaaaaggggaaatatttcttctgaagag |
272 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44678375 |
ggggtttgaaggtttgcttagatgtggtaaaagttgtagattaagatggattaactatttgagagctgatctcaaaaggggaaatatttcttctgaagag |
44678276 |
T |
|
| Q |
273 |
gaaagt |
278 |
Q |
| |
|
|||||| |
|
|
| T |
44678275 |
gaaagt |
44678270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 15 - 107
Target Start/End: Complemental strand, 44678532 - 44678440
Alignment:
| Q |
15 |
cagaggaggatgaaattttgacccaatatgttaaggcaaacggggaaggttcttggaggtcattgcccaaaaatgcaggtatcactattatta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44678532 |
cagaggaggatgaaattttgacccaatatgttaaggcaaatggggaaggttcttggaggtcattgcccaaaaatgcaggtatcactattatta |
44678440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University