View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376_low_71 (Length: 292)
Name: NF3376_low_71
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376_low_71 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 9 - 275
Target Start/End: Original strand, 15406631 - 15406902
Alignment:
| Q |
9 |
atagccaatgacccttttcaatacacaatttcgatggactagtttgacttctgnnnnnnnnta---ttcaa--caaagttatttcgattaggattgcagt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||| | ||||| ||||||||||||||||| |||||||| |
|
|
| T |
15406631 |
atagccaatgacccttttcaatacacaatttcgacggactaatttgacttctgaaaagaaaaaaaattcaatacaaagttatttcgattaaaattgcagt |
15406730 |
T |
 |
| Q |
104 |
tgcagttacgctgtgaaccttatattaaaaataaaatgtggacaaattataaagacttctaaaaccgttgaaatttggcctaactcattcttgcaaaacc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15406731 |
tgcagttacgctgtgaaccttatattaaaaataaaatgtggacaaattataaagacttctaaaaccgttgaaatttggcctaactcattcttgcaaaacc |
15406830 |
T |
 |
| Q |
204 |
gaactactgttgcatactacaatttagaactatgcaaaggaagatatataccttgattagtgatgagcctat |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15406831 |
gaactactgttgcatactacaatttagaactatgcaaaggaagatatataccttgattagtgatgagcctat |
15406902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University