View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376_low_91 (Length: 251)
Name: NF3376_low_91
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376_low_91 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 17 - 236
Target Start/End: Complemental strand, 29726849 - 29726630
Alignment:
| Q |
17 |
agatgagggggttaccggcatcagcgggtcatgtagccggtataaagtcgttgagaaggatggtgatgttgtgttatagttggggaataaaggttctaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29726849 |
agatgagggggttaccggcatcagcgggtcatgtagccggtataaagtcgttgagaaggatggtgatgttgtgttatagttggggaataaaggttctaac |
29726750 |
T |
 |
| Q |
117 |
tgtttttgcattctcaaccgataattggattcgacctaaggtcattttaatttcacttgttagtttagttcactttgattaacatgacattagttgttga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29726749 |
tgtttttgcattctcaaccgataattggattcgacctaaggtcattttaatttcacttgttagtttagttcactttgatgaacatgacattagttgttga |
29726650 |
T |
 |
| Q |
217 |
tagtggttatgcttggtttt |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
29726649 |
tagtggttatgcttggtttt |
29726630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University