View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3376_low_91 (Length: 251)

Name: NF3376_low_91
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3376_low_91
NF3376_low_91
[»] chr5 (1 HSPs)
chr5 (17-236)||(29726630-29726849)


Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 17 - 236
Target Start/End: Complemental strand, 29726849 - 29726630
Alignment:
17 agatgagggggttaccggcatcagcgggtcatgtagccggtataaagtcgttgagaaggatggtgatgttgtgttatagttggggaataaaggttctaac 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29726849 agatgagggggttaccggcatcagcgggtcatgtagccggtataaagtcgttgagaaggatggtgatgttgtgttatagttggggaataaaggttctaac 29726750  T
117 tgtttttgcattctcaaccgataattggattcgacctaaggtcattttaatttcacttgttagtttagttcactttgattaacatgacattagttgttga 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
29726749 tgtttttgcattctcaaccgataattggattcgacctaaggtcattttaatttcacttgttagtttagttcactttgatgaacatgacattagttgttga 29726650  T
217 tagtggttatgcttggtttt 236  Q
    ||||||||||||||||||||    
29726649 tagtggttatgcttggtttt 29726630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University