View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376_low_93 (Length: 249)
Name: NF3376_low_93
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376_low_93 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 4031294 - 4031526
Alignment:
| Q |
1 |
tatatagcaaatcctcttcttaaataatagccgtgttgcagttgcaattttttacatgtactaaaattgggttatatacaaattatggtcacaattgcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4031294 |
tatatagcaaatcctcttcttaaataatagccgtgttgcagttgcaattttttatatgtactaaaattgggttatatacaaattatggtcacaattgcaa |
4031393 |
T |
 |
| Q |
101 |
tcacaaagtaatcgcaaagatataaaataaacattgacgtcgccaccatgatagcagtggtagatcgnnnnnnnnnnnnngaacaaagtggtagatcgtt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4031394 |
tcacaaagtaatcgcaaagatataaaataaacattgacgtcgccaccatgatagcagtggtagatcgtttttgtttttttgaacaaagtggtagatcgtt |
4031493 |
T |
 |
| Q |
201 |
tttctaaaacattgtaggtagtcttgtttggat |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4031494 |
tttctaaaacattgtaggtagtcttgtttggat |
4031526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University