View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3376_low_98 (Length: 243)
Name: NF3376_low_98
Description: NF3376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3376_low_98 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 3e-44; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 43 - 148
Target Start/End: Complemental strand, 4305652 - 4305549
Alignment:
| Q |
43 |
ttgaagaaagtgagagtgatgagagagcggtggaagctttatactattactagtactactatagtatattgtatttatgcatgtgaggagctaaaaacac |
142 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4305652 |
ttgaagaaagtgagagtgaagagagagcggtggaagctttatactattactagtactac--tagtatattgtatttatgcatgtgaggagctaaaaacac |
4305555 |
T |
 |
| Q |
143 |
acacga |
148 |
Q |
| |
|
|||||| |
|
|
| T |
4305554 |
acacga |
4305549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 4305724 - 4305680
Alignment:
| Q |
1 |
ttgaaaattcataggtgtcatgttgtgatgattcatactgttttg |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4305724 |
ttgaaaattcataggtgtcatgttgtgatgattcatactgttttg |
4305680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 195 - 235
Target Start/End: Complemental strand, 4305526 - 4305486
Alignment:
| Q |
195 |
acagaaactgctagcggtgttgggaggtccacatccattgt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4305526 |
acagaaactgctagcggtgttgggaggtccacatccattgt |
4305486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University