View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3377_high_10 (Length: 238)
Name: NF3377_high_10
Description: NF3377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3377_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 15 - 222
Target Start/End: Original strand, 21820428 - 21820635
Alignment:
| Q |
15 |
aaaaatagcaatgattgataagcaagggggagnnnnnnnttgatgacatttctcctctcttcctttgatagtctcttgtattttagcattctagtactta |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |
|
|
| T |
21820428 |
aaaaatagcaatgattgataagcaaaggggagaaaaaaattgatgacatttctcctctcttcctttgatagtctcttgtattttagtattctagtattta |
21820527 |
T |
 |
| Q |
115 |
tattatattccacgagtggattaatttcatcttacttttatatctggttttattgtaatttcatatactctttatttaatccaaattgcataatatccat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21820528 |
tattatattccacgagtggattaatttcatcttacttttatatctggttttattgtaatttcatatactctttatttaatccaaattgcataatatccat |
21820627 |
T |
 |
| Q |
215 |
ccattcat |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
21820628 |
ccattcat |
21820635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University