View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3377_low_3 (Length: 287)
Name: NF3377_low_3
Description: NF3377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3377_low_3 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 271
Target Start/End: Complemental strand, 115488 - 115218
Alignment:
| Q |
1 |
tgtaccagaaacattggtgttataagcctccaccattctccaaccatgatcaaatggtttatctttgctccatatagcattggaagtgaaaacagctcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
115488 |
tgtaccagaaacattggtgttataagcctccaccattctccaaccatgatcaaatggtttatctttgctccatatagcattggaagtgaaaacagctcta |
115389 |
T |
|
| Q |
101 |
agttatcattccttataggacttgcaatttcaaatagaaacactccaatgttcactgatgccaatatacctctgcaccaaacataacaacatagagggat |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
115388 |
agttattattccttataggacttgcaatttcaaatagaaacactccaatgttcactgatgccaatatacctctgcaccaaacataacaacatagagggat |
115289 |
T |
|
| Q |
201 |
gaaaaagagttatttataatatgtaagatgatagacaattgagtaaataggtaaattggtcctcaaaattg |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
115288 |
gaaaaagagttatttataatatgtaagatgatagacaattgagaaaataggtaaattggtcctcaaaattg |
115218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University