View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3377_low_8 (Length: 249)
Name: NF3377_low_8
Description: NF3377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3377_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 10 - 125
Target Start/End: Original strand, 2465425 - 2465539
Alignment:
| Q |
10 |
gcagagagaacataccttacgagaaaactaaaccttctcttcacctttgaagaagttctcttttatagacccaatgtaacaacttcccgattttattcct |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2465425 |
gcagagagaacataccttacgagaaaactaaaccttctcttcacctttgaagaagttct-ttttatagacccaatgtaacaacttcccgattttattcct |
2465523 |
T |
 |
| Q |
110 |
ttaaaagaatcttacc |
125 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
2465524 |
ttgaaagaatcttacc |
2465539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University