View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3378R-Insertion-10 (Length: 337)
Name: NF3378R-Insertion-10
Description: NF3378R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3378R-Insertion-10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
| [»] scaffold0061 (1 HSPs) |
 |  |  |
|
| [»] scaffold0017 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 5e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 234 - 337
Target Start/End: Complemental strand, 8349622 - 8349519
Alignment:
| Q |
234 |
ttttagttatacgaatatcaacaatggttgtaaaattgtagaaatataatagctagaaagaaataccaagactaaaattctattcataatatctatatca |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
8349622 |
ttttagttatacgaatatcaacaatggttgtaaaattgtagaaatatattagctagaaagaaatcccaagactaaaattctattcataatatctatatca |
8349523 |
T |
 |
| Q |
334 |
ctca |
337 |
Q |
| |
|
|||| |
|
|
| T |
8349522 |
ctca |
8349519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 221 - 312
Target Start/End: Original strand, 11993658 - 11993749
Alignment:
| Q |
221 |
aattgtagaaatgttttagttatacgaatatcaacaatggttgtaaaattgtagaaatataatagctagaaagaaataccaagactaaaatt |
312 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||| |||||||||||||||||| |||||| ||| |||| |||||||||||||| |
|
|
| T |
11993658 |
aattgtagaaatgttttagttatacacatatcaacagtggtggtaaaattgtagaaatattttagctacaaacaaatcccaagactaaaatt |
11993749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 9 - 87
Target Start/End: Original strand, 44799728 - 44799806
Alignment:
| Q |
9 |
gtgaagggaatgaactggttttggtttatgagtatttaccatatggaagccttcataaagttcttcatagaaatttaag |
87 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||| ||||||||||| |||||||||| ||||| |||||||| |
|
|
| T |
44799728 |
gtgaagggaatgaattggttttggtttatgagtatctaccaaatggaagccttgataaagttctgcataggaatttaag |
44799806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 203 - 257
Target Start/End: Complemental strand, 44614647 - 44614593
Alignment:
| Q |
203 |
agtgagaaatgcaataaaaattgtagaaatgttttagttatacgaatatcaacaa |
257 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||| || |||||||||| |
|
|
| T |
44614647 |
agtgagaaatgcaatacaaattatagaaatgctttagttacacatatatcaacaa |
44614593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 203 - 257
Target Start/End: Original strand, 44793922 - 44793976
Alignment:
| Q |
203 |
agtgagaaatgcaataaaaattgtagaaatgttttagttatacgaatatcaacaa |
257 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| |||||||| || |||||||||| |
|
|
| T |
44793922 |
agtgagaaatgcaatacaaattatagaaatgctttagttacacatatatcaacaa |
44793976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0061 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0061
Description:
Target: scaffold0061; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 242
Target Start/End: Original strand, 27216 - 27253
Alignment:
| Q |
205 |
tgagaaatgcaataaaaattgtagaaatgttttagtta |
242 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
27216 |
tgagaaatgcaatacaaattgtagaaatgctttagtta |
27253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0017 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0017
Description:
Target: scaffold0017; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 242
Target Start/End: Complemental strand, 171576 - 171539
Alignment:
| Q |
205 |
tgagaaatgcaataaaaattgtagaaatgttttagtta |
242 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
171576 |
tgagaaatgcaatacaaattgtagaaatgctttagtta |
171539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University