View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3378R-Insertion-13 (Length: 153)
Name: NF3378R-Insertion-13
Description: NF3378R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3378R-Insertion-13 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 3e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 3e-57
Query Start/End: Original strand, 9 - 153
Target Start/End: Complemental strand, 40079688 - 40079543
Alignment:
| Q |
9 |
ctyatctcttaccttttgctcattttagaattgggttaatgattt-gaggtaactattgcgcgcgagaaaaggaattgggggaattttcctccatgattt |
107 |
Q |
| |
|
|| |||| ||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40079688 |
ctcatctgttaccttttgctcattttagaattgggttaatgattttgaggcaactattgcgcgagagaaaaggaattgggggaattttcctccatgattt |
40079589 |
T |
|
| Q |
108 |
ttccgtccatttgacacaaatatatttgaagatcatgtgtccattc |
153 |
Q |
| |
|
| ||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
40079588 |
tcccgtccatttgacacaaatatatttgaaggtcatgtgcccattc |
40079543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University