View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3378R-Insertion-15 (Length: 87)
Name: NF3378R-Insertion-15
Description: NF3378R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3378R-Insertion-15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 46; Significance: 7e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 7e-18
Query Start/End: Original strand, 9 - 58
Target Start/End: Original strand, 29643103 - 29643152
Alignment:
| Q |
9 |
gtttctgcacacattttcctttgtcacatttgggctctgtattgtattca |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29643103 |
gtttctgcacacattttcctttgtcacatttgggctttgtattgtattca |
29643152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University