View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3379-Insertion-14 (Length: 206)
Name: NF3379-Insertion-14
Description: NF3379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3379-Insertion-14 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 8 - 206
Target Start/End: Complemental strand, 7108459 - 7108261
Alignment:
| Q |
8 |
tgtaagccattagaggagggagggttaggtattagatatctaatccatcttaatgaagcttataatcttaagctttgttgagagaatggcgtcttctgat |
107 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7108459 |
tgtaagccattagaggaaggagggttaggtattagatatctaatccatcttaatgaagcttataatcttaagctttgttgggagaatggcgtcttctgat |
7108360 |
T |
 |
| Q |
108 |
acggatcgggcaaagatgttaaggtctagagttttaaaaaacgatagatgtatttcttatcatattttctcctctttatcgagtagttttaaaagtgag |
206 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7108359 |
acggattgggcaaagatgttaaggtctagagttttaaaaaatgatagatgtatttcttatcatattttctcctctttatcgagtagttttaaaagtgag |
7108261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University