View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3379-Insertion-20 (Length: 167)
Name: NF3379-Insertion-20
Description: NF3379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3379-Insertion-20 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 2e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 7 - 166
Target Start/End: Original strand, 32313355 - 32313514
Alignment:
| Q |
7 |
agtttctcgatgtccgattcctccacgcgccggtctaggccaacaacagtggcgagttcttgttgcacacgctttagttcttctggatttctcattagct |
106 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32313355 |
agtttctcgatgtctgattcctccacgcgccggtctaggccaacaacaacggcgagttcttgttgcacacgctttagttcttctggatttctcattagct |
32313454 |
T |
|
| Q |
107 |
ccgacattgcccattccattgctgatgctactgtttctgttcctccgaacatcacatcct |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32313455 |
ccgacattgcccattccattgctgatgctactgtttctgttcctccgaacatcacatcct |
32313514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 78 - 166
Target Start/End: Complemental strand, 8261723 - 8261635
Alignment:
| Q |
78 |
ctttagttcttctggatttctcattagctccgacattgcccattccattgctgatgctactgtttctgttcctccgaacatcacatcct |
166 |
Q |
| |
|
|||||| |||||||| || |||||| ||| | ||| |||||||| |||||||||||||| ||||| |||||||| |||||||| |||| |
|
|
| T |
8261723 |
ctttaggtcttctgggcttttcattaactctgccatggcccattcaattgctgatgctaccgtttccgttcctccaaacatcacgtcct |
8261635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 98 - 167
Target Start/End: Original strand, 27145407 - 27145476
Alignment:
| Q |
98 |
tcattagctccgacattgcccattccattgctgatgctactgtttctgttcctccgaacatcacatccta |
167 |
Q |
| |
|
|||||||||| | ||||| |||||| || ||||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
27145407 |
tcattagctctgccattgtccattctatcactgatgctactgtctcagttcctccaaacatcacatccta |
27145476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University