View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3379R-Insertion-8 (Length: 133)
Name: NF3379R-Insertion-8
Description: NF3379R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3379R-Insertion-8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 77; Significance: 4e-36; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 77; E-Value: 4e-36
Query Start/End: Original strand, 9 - 133
Target Start/End: Original strand, 30242528 - 30242652
Alignment:
| Q |
9 |
agaacaaaccaaacatgttaatatgtttagaaatagtatccattcaaaaacaagtctccactttactttaaannnnnnnnnnnngttgcgtgacttcgaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
30242528 |
agaacaaaccaaacatgttaatatgtttagaaataatatccattcaaaaacaagtctccactttactttaaattttttctttttgttgtgtgacttcgaa |
30242627 |
T |
|
| Q |
109 |
tcacgcaaaacctcttcatcctcat |
133 |
Q |
| |
|
||||||||||||||||| ||||||| |
|
|
| T |
30242628 |
tcacgcaaaacctcttcgtcctcat |
30242652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University