View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3379_low_15 (Length: 245)
Name: NF3379_low_15
Description: NF3379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3379_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 37027457 - 37027689
Alignment:
| Q |
1 |
tagtttccactcttttccctttgtgtggtaaaccatgcatataaattatatgattatttcatatactaatctatctatgtaactttagttt-----gtgt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
37027457 |
tagtttccactcttttccctttgtgtggtaaaccatgcatataaattatatgattatttcatatactaatctatctatgtaacttcagtttaatttgtgt |
37027556 |
T |
 |
| Q |
96 |
aataatttataaaacatatgtaacttttgttaaatttgcagatgctataaatcatggaagaggtagtagaagctactccatcaaatcatggaagaaactc |
195 |
Q |
| |
|
| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37027557 |
agtaattaataaaacatatgtaacttttgttaaatttgcagatgctataaatcatggaagaggtagtagaagctactccatcaaatcatggaagaaactc |
37027656 |
T |
 |
| Q |
196 |
aaattttcatcatttggctactcagacttagat |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37027657 |
aaattttcatcatttggctactcagacttagat |
37027689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University