View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3379_low_8 (Length: 342)
Name: NF3379_low_8
Description: NF3379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3379_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 13 - 134
Target Start/End: Original strand, 11109719 - 11109843
Alignment:
| Q |
13 |
aatatatgtagggttggtctaaaggtaagactactaaaacctttgttctaggccctt----gttaatttaataattgtcatatttgccaaagattaatag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11109719 |
aatatatgtagggttggtctaaaggtaagactactaaaacctttgt-ctaggccctttcttgttaatttaataattgtcatatttgccaaagattaatag |
11109817 |
T |
 |
| Q |
109 |
tgtcattgctagttaattttcaacat |
134 |
Q |
| |
|
||||||| |||||||||||||||||| |
|
|
| T |
11109818 |
tgtcattactagttaattttcaacat |
11109843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 255 - 325
Target Start/End: Original strand, 11109963 - 11110033
Alignment:
| Q |
255 |
ctctttcttttacttataataccttgtctctaatttatgggacataatatgacaattttttatgatcatat |
325 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11109963 |
ctctttcttttacttataataccttctctctaatttatgggacataatatgacaattttttattatcatat |
11110033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University