View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3381_low_2 (Length: 369)
Name: NF3381_low_2
Description: NF3381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3381_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 289
Target Start/End: Complemental strand, 39023580 - 39023309
Alignment:
| Q |
18 |
gtgagatgtgctggcattggtttctgccttcgaaattttggttggcacgagctggcagccagtacggattggaaaatatggaacttcaaaccagttgaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39023580 |
gtgagatgtgctggcattggtttctgccttcaaaattttggttgagacgagctggcagccagtacggattggaaaatatggaacttcaaaccagttgaag |
39023481 |
T |
 |
| Q |
118 |
gagtggcttggagtctcatccaagcaattagtaatagtggatagcttccttcagcctcaatctcacatcttattttttagatgaattgcatgcaagtagt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39023480 |
gagtggcttggagtctcatccaagcaattagtaatagtggatagcttccttcagcctcaatctcacatcttattttttagatgaattgcatgcaagtagt |
39023381 |
T |
 |
| Q |
218 |
taatgatgtgtttaatgttaagtttaagttaaaattatacagtatggatttttagtaaatgcatgtatatct |
289 |
Q |
| |
|
|||||||||| | |||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39023380 |
taatgatgtgctaaatgttaattttaagttaaaattataccttatggatttttagtaaatgcatgtatatct |
39023309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 273 - 340
Target Start/End: Complemental strand, 39023172 - 39023105
Alignment:
| Q |
273 |
taaatgcatgtatatctatcaaattgtttttgttatgcgatctccaaatagtaaatgttccctctctt |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39023172 |
taaatgcatgtatatctatcaaattgtttttgttatgcgatctccaaatagtaaatgttccctctctt |
39023105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University