View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3382_high_17 (Length: 236)

Name: NF3382_high_17
Description: NF3382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3382_high_17
NF3382_high_17
[»] chr7 (1 HSPs)
chr7 (91-204)||(17356138-17356249)


Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 91 - 204
Target Start/End: Original strand, 17356138 - 17356249
Alignment:
91 gtgcttcatgcgaacttcgatttcgtgatttgttgttttccttcaccttattgtttgtagaagagcagcatacaattgttttggatttttcatgaaaaat 190  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| || ||||||||  |||||||||||||||||||||||||||    
17356138 gtgcttcatgcgaacttcgatttcgtgatttgttgtttttcttcaccttcttgtttgtacaaaagcagcat--aattgttttggatttttcatgaaaaat 17356235  T
191 tattctaaattcat 204  Q
    ||||||||||||||    
17356236 tattctaaattcat 17356249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University