View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3382_high_17 (Length: 236)
Name: NF3382_high_17
Description: NF3382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3382_high_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 91 - 204
Target Start/End: Original strand, 17356138 - 17356249
Alignment:
| Q |
91 |
gtgcttcatgcgaacttcgatttcgtgatttgttgttttccttcaccttattgtttgtagaagagcagcatacaattgttttggatttttcatgaaaaat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| || |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17356138 |
gtgcttcatgcgaacttcgatttcgtgatttgttgtttttcttcaccttcttgtttgtacaaaagcagcat--aattgttttggatttttcatgaaaaat |
17356235 |
T |
 |
| Q |
191 |
tattctaaattcat |
204 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
17356236 |
tattctaaattcat |
17356249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University