View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3382_high_18 (Length: 233)

Name: NF3382_high_18
Description: NF3382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3382_high_18
NF3382_high_18
[»] chr1 (1 HSPs)
chr1 (148-216)||(7364479-7364547)


Alignment Details
Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 148 - 216
Target Start/End: Complemental strand, 7364547 - 7364479
Alignment:
148 ggtggtgtaggagagggtgatgaagtagtattttgagggggtgtagaaagttctgggaggttaagtttt 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7364547 ggtggtgtaggagagggtgatgaagtagtattttgagggggtgtagaaagttctgggaggttaagtttt 7364479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University