View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3382_low_7 (Length: 372)
Name: NF3382_low_7
Description: NF3382
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3382_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 6e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 6e-90
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 24819004 - 24819182
Alignment:
| Q |
20 |
aacacacaccttgatagcaaacaaaggatgaagaaataggcaaaaatgtgtgccttttcactttagagtgttacatatatatatagggaaaatagaacca |
119 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24819004 |
aacacacaccttgatagcaaacaacggatgaagaaataggcaaaaatgtgtgccttttcactttagagtgttacatatatatatagggaaaatagaacca |
24819103 |
T |
 |
| Q |
120 |
ctcatcagtgcccccatttaatttaccattaaaagatgatcatcggtcaatccttgcattcatatatcataacttatcta |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
24819104 |
ctcatcagtgcccccatttaatttaccattaaaagatgatcatcggtcaatccttgcattcatatatcat-acttatcta |
24819182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 200 - 306
Target Start/End: Original strand, 24819242 - 24819349
Alignment:
| Q |
200 |
tttgaaagcattcaatccttctaagtggtaactggtaatccaccaa-cattccactttgtaattccaatttcctatgtgctgataccaacgtgtattttg |
298 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24819242 |
tttgaaagcattcaattcttctaagtggtaactggtaatccaccaaacattccactttgtaattccaatttcctatgtgctgataccaacgtgtattttg |
24819341 |
T |
 |
| Q |
299 |
actgtcag |
306 |
Q |
| |
|
|||||||| |
|
|
| T |
24819342 |
actgtcag |
24819349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University