View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3383_low_5 (Length: 305)
Name: NF3383_low_5
Description: NF3383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3383_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 28031413 - 28031644
Alignment:
| Q |
1 |
taacttggcattttatcgttctcataaatatatctttgttctcatatttgtaattttattaaacttgatagttttagtaaatattacttggaattttatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28031413 |
taacttggcattttatcgttctcataaatatatctttgttttcatatttgtaattttattaaacttgatagttttagtaaatattacttggaattttatt |
28031512 |
T |
|
| Q |
101 |
aagtattttctaacctttgagagaatattgtataattgagcttcgttatgcatgc--nnnnnnnnnncttgttgtcttagaagtcacatatgtaaaaggc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28031513 |
aagtattttctaacctttgagagaatattgtataattgagcttcgttatgcatgcttttttcttcttcttgttgtcttagaagtcacatatgtaaaaggc |
28031612 |
T |
|
| Q |
199 |
ttatcacttgtagatttacgattttgtaaata |
230 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |
|
|
| T |
28031613 |
ttatcacttgtaaatttacgattttgtaaata |
28031644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 225 - 289
Target Start/End: Original strand, 28032036 - 28032100
Alignment:
| Q |
225 |
taaatatataaaagttgtcgtgtcctcctcatcggtacattctattagtagtttctctaacattt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28032036 |
taaatatataaaagttgtcgtgtcctcctcgtcggtacattctattagtagtttctctaacattt |
28032100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University