View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3386_high_11 (Length: 420)
Name: NF3386_high_11
Description: NF3386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3386_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 75 - 403
Target Start/End: Original strand, 43064316 - 43064645
Alignment:
| Q |
75 |
cgggcaggtttgggcccaaaaccccaatccagcccaacccgcgggtgtcatgtagtggcccatctctgcccaatattccacacggtttagacgggtttcg |
174 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43064316 |
cgggcgggttcgggcccaaaaccccaatccagcccaactcgcgggtgtcatgtagtggcccatctctgcccaatattccacacggtttagacgggtttcg |
43064415 |
T |
|
| Q |
175 |
ggtgaaacgggtgtcgggttttcgggtgggtttagacaggttttaacnnnnnnnnntcagtannnnnnnngtgaaattgctatcatctttagtttcaaag |
274 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||| |||||| |||||||||| |||||||||||||||||| |
|
|
| T |
43064416 |
ggtgaaacgggtgtcggattttcgggtgggtttagacgggttttaac-aaaaaaaatcagtattttttttgtgaaattgccgtcatctttagtttcaaag |
43064514 |
T |
|
| Q |
275 |
atcaacaatccggttctt--nnnnnnnntcaaacaatccagaaaaaagaaagagtgaatataatcaatagatctataagaaacatcatcaacaatcatct |
372 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43064515 |
atcaacaatccggttcttaaaaaaaatatcaaacaatccaaaaaaaagaaagagtgaatataatcaatagatctataagaaacatcatcaacaatcatct |
43064614 |
T |
|
| Q |
373 |
agatctagatctcttcatcaaccgttgtcta |
403 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |
|
|
| T |
43064615 |
agatctagatctcttcatcaacagttgtcta |
43064645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University