View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3386_high_25 (Length: 250)
Name: NF3386_high_25
Description: NF3386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3386_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 6 - 234
Target Start/End: Complemental strand, 41706077 - 41705849
Alignment:
| Q |
6 |
cagagatatagtagtaatagtgatggataaggaaattatcttaacatgtgttttaaacattctctgtgtagtcggccccacttaatgctactgcgataag |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | ||||||||||||| |
|
|
| T |
41706077 |
cagacatatagtagtaatagtgatggataaggaaattatcttaacatgtgttttaaacattctctgtgtagtaggccccacttagtactactgcgataag |
41705978 |
T |
 |
| Q |
106 |
acttggttgttgttgttctaattgatgatgcgttttaaatattatatcaattgtttgaaccctgaattcactaacagatattaacaatgtaactctaacg |
205 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||| ||| ||||| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41705977 |
acttggttgttgttgttctagttgatgatgcattttaaacattctatcagttgtttgaaccctgaattcactaacagatattaacagtgtaactctaacg |
41705878 |
T |
 |
| Q |
206 |
tacttgacacatgaatcatgtgtcaagta |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41705877 |
tacttgacacatgaatcatgtgtcaagta |
41705849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University