View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3386_low_14 (Length: 398)
Name: NF3386_low_14
Description: NF3386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3386_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 17 - 207
Target Start/End: Complemental strand, 45399553 - 45399363
Alignment:
| Q |
17 |
taactttaaaataattaatctttgtacttcnnnnnnntcatattttttcaatggttacatttatggcagtgagtagtatgcatgagcattaacacggccg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45399553 |
taactttaaaataattaatctttgtacttcaaaaaaatcatattttttcaatggttacatttatggcggtgagtagtatgcatgagcattaacacggccg |
45399454 |
T |
|
| Q |
117 |
tatggaataattatcggtcttcgctctatgttcgaaattgggtcgtcgtattacaacactgcctaaactgacccataaggtcgcaacattt |
207 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
45399453 |
tatggaataattatcggccttcgctctatgttcgaaattgggtcgtcgtattacatcactgcctaaactgacccataaggtcacaacattt |
45399363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 296 - 387
Target Start/End: Complemental strand, 45399367 - 45399274
Alignment:
| Q |
296 |
catttgtgaacactactaatatgggtttaggcacgcccatgcctcctactctcatggtttgagatctaacatc--tgtgtttcactggtccttt |
387 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
45399367 |
catttgtgaacactactaatatgcgtttaggcacgcccatgcctcctactctcatggtttgagatctaacatctatgtgtttcactagtccttt |
45399274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University