View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3386_low_30 (Length: 249)
Name: NF3386_low_30
Description: NF3386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3386_low_30 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 124 - 240
Target Start/End: Original strand, 2748441 - 2748557
Alignment:
| Q |
124 |
gaatttaattcccagttcaggtttgactaaaaatacctctnnnnnnnggtttaaccaaaataatataaagaactaaaatgatgtatagtgtagtatgttg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2748441 |
gaatttaattcccagttcaggtttgactaaaaatgcctctaaaaaaaggtttaaccaaaataatataaagaactaaaatgatgtatagtgtagtatgttg |
2748540 |
T |
 |
| Q |
224 |
ttgtctaatatattctt |
240 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
2748541 |
ttgtctaatattttctt |
2748557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 3 - 85
Target Start/End: Original strand, 2748320 - 2748402
Alignment:
| Q |
3 |
tgcacatagggaggggactgtagttacctatttagttggacttttcaagtcagaagttggaatgacaccagatagatacatca |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2748320 |
tgcacatagggaggggactgtagttacctatttagttgaacttttcaagtcagaagttggaataacaccagatagatacatca |
2748402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University