View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3386_low_34 (Length: 236)
Name: NF3386_low_34
Description: NF3386
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3386_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 51504822 - 51504903
Alignment:
| Q |
1 |
ataagagcatgcatgagtatctagatatcattttgtgtgtcttgtctaaacaaaacagaacaacaacatgtgtgtcctgtct |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
51504822 |
ataagagcatgcatgagtatctagatatcattttgtgtgtcttgtctaaacaaaacagaacaacaacatgtgtgtcttgtct |
51504903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 157 - 220
Target Start/End: Original strand, 51504980 - 51505043
Alignment:
| Q |
157 |
tagtatttggtaccttggagagaaaagagtggaaggttgaatgtagcaccagcatccaagaaag |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51504980 |
tagtatttggtaccttggagagaaaagagtggaaggttgaatgtagcaccagcatccaagaaag |
51505043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University