View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3388_high_10 (Length: 417)
Name: NF3388_high_10
Description: NF3388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3388_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 381; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 381; E-Value: 0
Query Start/End: Original strand, 1 - 401
Target Start/End: Complemental strand, 10976149 - 10975749
Alignment:
| Q |
1 |
aaaccaagcaacgatgtaaactcaaatctaaaagcattctcagcagcactagcactctcatcaatcctcatctcatcaccactccccgctgtcgccgaca |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10976149 |
aaaccaaccaacgatgtaaactcaaatctaaaagcattctcagcagcactagcactctcatcaatcctcatctcatcaccactccccgctgtcgccgaca |
10976050 |
T |
 |
| Q |
101 |
tctccggtctaacaccatgcagagaatcaaaacaattcgccaaacgtgagaaacaatcaatcaaaaagcttgaatcatccctcaagctttacgctccgga |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10976049 |
tctccggcctaacaccatgcagagaatcaaaacaattcgccaaacgtgagaaacaatcaatcaaaaagcttgaatcatcactcaagctttacgctccgga |
10975950 |
T |
 |
| Q |
201 |
cagtgctccagcgctggccataaaagcaacagttgagaaaaccaagagaaggtttgataactatggaaagcaaggtttgttgtgtggtgctgatggttta |
300 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10975949 |
cagcgctccagcgctggccataaaagcaacagttgagaaaaccaagagaaggtttgataactatggaaagcaaggtttgttgtgtggtgctgatggttta |
10975850 |
T |
 |
| Q |
301 |
ccgcatttgatagtgaatggtgatcaaagacattggggtgagtttatcacaccagggatattgtttttgtatattgctggttggattggatgggttggta |
400 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10975849 |
ccacatttgatagtgaatggtgatcaaagacattggggtgagtttatcacaccagggatattgtttttgtatattgctggttggattggatgggttggta |
10975750 |
T |
 |
| Q |
401 |
g |
401 |
Q |
| |
|
| |
|
|
| T |
10975749 |
g |
10975749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University