View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3388_high_26 (Length: 279)
Name: NF3388_high_26
Description: NF3388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3388_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 50410855 - 50410584
Alignment:
| Q |
1 |
tttaatgattaattggtttgttatgattataatttattctgtagtttatgaagactcaagagtcgatgtttgtgaacaatatgatggctaataagtcaac |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50410855 |
tttaatgattaatttgtttgttatgattataatttattctgtagtttatgaagactcaagggtcgatgtttgtgaacaatatgatggctaataagtcaac |
50410756 |
T |
|
| Q |
101 |
actgttgactaaagattgttcatctttcactcaaggaagaggggatagttttcagaatcataaatcaacctccagttactttgctggatcttttcttcct |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50410755 |
attgttgactaaagattgttcatctttcactcaaggaagaggggatagttttcagaatcataaatcaacctccagttactttgctggatcttttcttcct |
50410656 |
T |
|
| Q |
201 |
tggcattggtcagtgtttgcattctcatgctgttgttcattctaggattcaattatgttatcttctgtgctg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50410655 |
tggcattggtcagtgtttgcattctcatgctgttgttcattctaggattcaattatgttatcttctgtgctg |
50410584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University