View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3388_high_30 (Length: 250)

Name: NF3388_high_30
Description: NF3388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3388_high_30
NF3388_high_30
[»] chr7 (5 HSPs)
chr7 (79-161)||(40320483-40320566)
chr7 (90-140)||(35959176-35959226)
chr7 (174-204)||(40322552-40322582)
chr7 (96-204)||(37628473-37628579)
chr7 (107-165)||(17352956-17353016)
[»] chr8 (6 HSPs)
chr8 (75-204)||(45519391-45519520)
chr8 (107-204)||(23753287-23753386)
chr8 (90-140)||(14054210-14054260)
chr8 (90-197)||(45518203-45518312)
chr8 (81-139)||(36984238-36984296)
chr8 (82-140)||(39688436-39688494)
[»] chr5 (5 HSPs)
chr5 (75-140)||(9071881-9071946)
chr5 (81-199)||(2023365-2023482)
chr5 (90-153)||(9070753-9070816)
chr5 (196-237)||(25496105-25496146)
chr5 (200-237)||(28222652-28222689)
[»] chr1 (3 HSPs)
chr1 (81-204)||(22778543-22778667)
chr1 (81-153)||(1531715-1531788)
chr1 (105-137)||(31377603-31377635)
[»] scaffold0050 (1 HSPs)
scaffold0050 (95-140)||(80928-80973)
[»] chr6 (3 HSPs)
chr6 (82-138)||(21844265-21844321)
chr6 (114-204)||(20583913-20584004)
chr6 (90-140)||(21843243-21843293)
[»] chr4 (1 HSPs)
chr4 (81-140)||(46171381-46171440)
[»] chr2 (2 HSPs)
chr2 (75-138)||(21004545-21004608)
chr2 (76-140)||(30793940-30794004)
[»] chr3 (1 HSPs)
chr3 (90-140)||(37023722-37023772)


Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 79 - 161
Target Start/End: Complemental strand, 40320566 - 40320483
Alignment:
79 atatacacagctggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaa-gggctaaatatgggggtcactttt 161  Q
    |||||||||||||||||||||||||||||| | ||||||||||||| |||||||||||| ||||||||||||||||||||||||    
40320566 atatacacagctggcgtgacacatatgattaaccaagtcaaaattgatgttttgcaaaaggggctaaatatgggggtcactttt 40320483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 90 - 140
Target Start/End: Complemental strand, 35959226 - 35959176
Alignment:
90 tggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaaggg 140  Q
    |||||||||| ||| | ||||||||||||||||| ||||||||||||||||    
35959226 tggcgtgacagataggcttgatcaagtcaaaattagtgttttgcaaaaggg 35959176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 174 - 204
Target Start/End: Original strand, 40322552 - 40322582
Alignment:
174 aatagggggccaaaattgcaacttttacaaa 204  Q
    |||||||||||||||||||||||||||||||    
40322552 aatagggggccaaaattgcaacttttacaaa 40322582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 96 - 204
Target Start/End: Original strand, 37628473 - 37628579
Alignment:
96 gacacatatgattgatcaagtcaaaattggtgttttgcaaaag-ggctaaatatgggggtcacttttaccannnnnnnnaatagggggccaaaattgcaa 194  Q
    |||||||| |||||||||  ||||||||| ||||||||||||| ||||||| ||  ||||||||||| |||        ||||||||||||||||| |||    
37628473 gacacataggattgatcagatcaaaattgatgttttgcaaaagaggctaaacat--gggtcacttttgcca-tttttttaatagggggccaaaattacaa 37628569  T
195 cttttacaaa 204  Q
    ||||| ||||    
37628570 cttttgcaaa 37628579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 107 - 165
Target Start/End: Complemental strand, 17353016 - 17352956
Alignment:
107 ttgatcaagtcaaaattggtgttttgcaaaa-gggctaaatatg-ggggtcacttttacca 165  Q
    |||| |||||||||||||| ||||||||||| ||| |||| ||| ||||||||||||||||    
17353016 ttgaccaagtcaaaattggagttttgcaaaagggggtaaacatgaggggtcacttttacca 17352956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 62; Significance: 7e-27; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 75 - 204
Target Start/End: Original strand, 45519391 - 45519520
Alignment:
75 caaaatatacacagctggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaagggctaaatatgggggtcacttttaccannnnnnnna 174  Q
    |||||| |||||||||||||||||| |||||||||| ||||| ||||||||||||||||||||||| || | ||| || |||||||| |||        |    
45519391 caaaatgtacacagctggcgtgacatatatgattgaccaagttaaaattggtgttttgcaaaagggatagacatgaggatcacttttgccaattttttta 45519490  T
175 atagggggccaaaattgcaacttttacaaa 204  Q
    ||||||||||||||||||||||||| ||||    
45519491 atagggggccaaaattgcaacttttgcaaa 45519520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 107 - 204
Target Start/End: Complemental strand, 23753386 - 23753287
Alignment:
107 ttgatcaagtcaaaattggtgttttgcaaaagggc-taaatatgggg-gtcacttttaccannnnnnnnaatagggggccaaaattgcaacttttacaaa 204  Q
    ||||||||||||||||||  ||||||||||||||  ||||||||||  ||||||||| |||        |||||||||||||||||||||||||||||||    
23753386 ttgatcaagtcaaaattgacgttttgcaaaaggggataaatatgggatgtcacttttgccattttttttaatagggggccaaaattgcaacttttacaaa 23753287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 90 - 140
Target Start/End: Complemental strand, 14054260 - 14054210
Alignment:
90 tggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaaggg 140  Q
    |||| ||||||||| | ||||||||||||||||||||||||||||||||||    
14054260 tggcatgacacataggtttgatcaagtcaaaattggtgttttgcaaaaggg 14054210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 90 - 197
Target Start/End: Complemental strand, 45518312 - 45518203
Alignment:
90 tggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaa-gggctaaatat-gggggtcacttttaccannnnnnnnaatagggggccaaa 187  Q
    ||||||||||| || ||||||||| |||||||||| | |||||||||| ||| ||||||| |||||||| |||| |||        ||||||||| ||||    
45518312 tggcgtgacacctaggattgatcaggtcaaaattgatcttttgcaaaaggggttaaatatggggggtcatttttgccactttttttaatagggggtcaaa 45518213  T
188 attgcaactt 197  Q
    ||||||||||    
45518212 attgcaactt 45518203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 81 - 139
Target Start/End: Complemental strand, 36984296 - 36984238
Alignment:
81 atacacagctggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaagg 139  Q
    |||||||| |||| ||||||||||| |||||  |||||||||||  |||||||||||||    
36984296 atacacaggtggcatgacacatatggttgattgagtcaaaattgaggttttgcaaaagg 36984238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 82 - 140
Target Start/End: Complemental strand, 39688494 - 39688436
Alignment:
82 tacacagctggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaaggg 140  Q
    ||||||| ||||| |||||||| |||||| |||||||| ||||| || |||||||||||    
39688494 tacacaggtggcgagacacataggattgaccaagtcaagattggagtattgcaaaaggg 39688436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 75 - 140
Target Start/End: Original strand, 9071881 - 9071946
Alignment:
75 caaaatatacacagctggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaaggg 140  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
9071881 caaaatatacacagctggcgtgacacatatgattgaccaagtcaaaattggtgttttgcaaaaggg 9071946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 81 - 199
Target Start/End: Complemental strand, 2023482 - 2023365
Alignment:
81 atacacagctggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaagggctaaatatgggggtcacttttaccannnnnnnnaataggg 180  Q
    |||||||| |||| || |||||||| |||| ||||| |||||||  |||||||||||||| || |||| |||||||||||| |||        |||||||    
2023482 atacacaggtggcatgccacatatggttgaccaagttaaaattgacgttttgcaaaaggggtagatat-ggggtcacttttgccattttttttaataggg 2023384  T
181 ggccaaaattgcaactttt 199  Q
    |||||||||||||||||||    
2023383 ggccaaaattgcaactttt 2023365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 90 - 153
Target Start/End: Complemental strand, 9070816 - 9070753
Alignment:
90 tggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaagggctaaatatggggg 153  Q
    ||||||||||| || ||||||||| |||||||||| | ||||||||||||| ||||||||||||    
9070816 tggcgtgacacctaggattgatcaggtcaaaattgatcttttgcaaaagggttaaatatggggg 9070753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 196 - 237
Target Start/End: Original strand, 25496105 - 25496146
Alignment:
196 ttttacaaaagttcacagctacgcagggtctagtcactctct 237  Q
    |||||||||| |||||||||| ||||||||||||||||||||    
25496105 ttttacaaaatttcacagctatgcagggtctagtcactctct 25496146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 200 - 237
Target Start/End: Complemental strand, 28222689 - 28222652
Alignment:
200 acaaaagttcacagctacgcagggtctagtcactctct 237  Q
    ||||||||||||||||||||| ||||||||||||||||    
28222689 acaaaagttcacagctacgcaaggtctagtcactctct 28222652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 57; Significance: 7e-24; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 81 - 204
Target Start/End: Original strand, 22778543 - 22778667
Alignment:
81 atacacagctggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaa-agggctaaatatgggggtcacttttaccannnnnnnnaatagg 179  Q
    ||||||||||||||||||||||| |||||| |||||||||||||||||||||||||  |||||||| ||||||||||  ||| ||         ||||||    
22778543 atacacagctggcgtgacacataggattgaccaagtcaaaattggtgttttgcaaatggggctaaacatgggggtcatgtttgcctttttttttaatagg 22778642  T
180 gggccaaaattgcaacttttacaaa 204  Q
    |||||||||||||||||||| ||||    
22778643 gggccaaaattgcaacttttgcaaa 22778667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 81 - 153
Target Start/End: Complemental strand, 1531788 - 1531715
Alignment:
81 atacacagctggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaa-gggctaaatatggggg 153  Q
    ||||||| ||| ||||||||||| |||||| || ||||||||||||||||||||||| |||||||| |||||||    
1531788 atacacaactgacgtgacacataggattgaccaggtcaaaattggtgttttgcaaaaggggctaaacatggggg 1531715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 105 - 137
Target Start/End: Original strand, 31377603 - 31377635
Alignment:
105 gattgatcaagtcaaaattggtgttttgcaaaa 137  Q
    ||||||||| |||||||||||||||||||||||    
31377603 gattgatcaggtcaaaattggtgttttgcaaaa 31377635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 95 - 140
Target Start/End: Original strand, 80928 - 80973
Alignment:
95 tgacacatatgattgatcaagtcaaaattggtgttttgcaaaaggg 140  Q
    ||||||||| |||||| |||||||||||||||||||||||||||||    
80928 tgacacataggattgaccaagtcaaaattggtgttttgcaaaaggg 80973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 82 - 138
Target Start/End: Original strand, 21844265 - 21844321
Alignment:
82 tacacagctggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaag 138  Q
    ||||||||||||| |||||||| |||||| ||||||||||||||  |||||||||||    
21844265 tacacagctggcgagacacataggattgaccaagtcaaaattgggattttgcaaaag 21844321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 114 - 204
Target Start/End: Original strand, 20583913 - 20584004
Alignment:
114 agtcaaaattggtgttttgcaaaagggctaaatatg-ggggtcacttttaccannnnnnnnaatagggggccaaaattgcaacttttacaaa 204  Q
    |||||||||||| |||||||||||||  |||||||| |||||||||||| |||        ||||||||| |||||||||||||||| ||||    
20583913 agtcaaaattggagttttgcaaaaggagtaaatatgaggggtcacttttgccattttttttaatagggggtcaaaattgcaacttttgcaaa 20584004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 90 - 140
Target Start/End: Complemental strand, 21843293 - 21843243
Alignment:
90 tggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaaggg 140  Q
    |||||||||||||| |||||||  |||||||||||| ||||||| ||||||    
21843293 tggcgtgacacataggattgatttagtcaaaattggggttttgctaaaggg 21843243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 81 - 140
Target Start/End: Original strand, 46171381 - 46171440
Alignment:
81 atacacagctggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaaggg 140  Q
    |||||||| ||||||||| |||| |||||| || ||||||||| ||||||||||||||||    
46171381 atacacagttggcgtgacgcataggattgaccaggtcaaaattagtgttttgcaaaaggg 46171440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 138
Target Start/End: Original strand, 21004545 - 21004608
Alignment:
75 caaaatatacacagctggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaag 138  Q
    ||||| |||||||| ||| ||||||||||  ||||| |||||||||||| ||||||||||||||    
21004545 caaaaaatacacagatggtgtgacacatagtattgaccaagtcaaaattagtgttttgcaaaag 21004608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 76 - 140
Target Start/End: Complemental strand, 30794004 - 30793940
Alignment:
76 aaaatatacacagctggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaaggg 140  Q
    |||| |||||||| |||| ||||||||| | ||||  |||||||||||| |||||||||||||||    
30794004 aaaaaatacacagttggcatgacacataggtttgactaagtcaaaattgatgttttgcaaaaggg 30793940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 90 - 140
Target Start/End: Original strand, 37023722 - 37023772
Alignment:
90 tggcgtgacacatatgattgatcaagtcaaaattggtgttttgcaaaaggg 140  Q
    |||| ||||||||| | |||| |||||||||||||||||||||||||||||    
37023722 tggcatgacacataggtttgaccaagtcaaaattggtgttttgcaaaaggg 37023772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University