View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3388_low_31 (Length: 247)
Name: NF3388_low_31
Description: NF3388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3388_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 43 - 232
Target Start/End: Original strand, 6386701 - 6386890
Alignment:
| Q |
43 |
gtgatgtggggtattaccagttggaaaaggaagtcattggagactccttggaagaggtagaccttctgcacaacaggaaaaaagagatggtgtgcgatgc |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6386701 |
gtgatgtggggtattaccagttggaaaaggaagtcattggagactccttggaagaggtagaccttctgcacaacaggaaaaaagagatggtgtgcgatgc |
6386800 |
T |
|
| Q |
143 |
ttgaccgaatcgcctttggaagatcatttaatgcttcttgctgcttcagtccttctgttttaaacctcaaacaaatgtgtgccaacattt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6386801 |
ttgaccgaatcgcctttggaagatcatttaatgcttcttgctgcttcagtccttctgttttaaacctcaaacaaatgtgtgccaacattt |
6386890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 85 - 203
Target Start/End: Original strand, 18167906 - 18168024
Alignment:
| Q |
85 |
actccttggaagaggtagaccttctgcacaacaggaaaaaagagatggtgtgcgatgcttgaccgaatcgcctttggaagatcatttaatgcttcttgct |
184 |
Q |
| |
|
|||| ||||||||| ||| ||||||||||||||| |||| ||||||||||| ||||||| ||||| || || || | |||||| || |||||||| |
|
|
| T |
18167906 |
actctttggaagagataggatttctgcacaacaggataaaaaagatggtgtgcaatgcttgcgcgaattgctttcggcatgccatttattgtttcttgct |
18168005 |
T |
|
| Q |
185 |
gcttcagtccttctgtttt |
203 |
Q |
| |
|
| || |||||||||||||| |
|
|
| T |
18168006 |
gttttagtccttctgtttt |
18168024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 85 - 203
Target Start/End: Original strand, 18631463 - 18631581
Alignment:
| Q |
85 |
actccttggaagaggtagaccttctgcacaacaggaaaaaagagatggtgtgcgatgcttgaccgaatcgcctttggaagatcatttaatgcttcttgct |
184 |
Q |
| |
|
|||| ||||||||| ||| ||||||||||||||| |||| ||||||||||| ||||||| ||||| || || || | |||||| || |||||||| |
|
|
| T |
18631463 |
actctttggaagagataggatttctgcacaacaggataaaaaagatggtgtgcaatgcttgcgcgaattgctttcggcatgccatttattgtttcttgct |
18631562 |
T |
|
| Q |
185 |
gcttcagtccttctgtttt |
203 |
Q |
| |
|
| || |||||||||||||| |
|
|
| T |
18631563 |
gttttagtccttctgtttt |
18631581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University