View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3388_low_32 (Length: 246)

Name: NF3388_low_32
Description: NF3388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3388_low_32
NF3388_low_32
[»] chr7 (7 HSPs)
chr7 (7-231)||(26836099-26836323)
chr7 (4-231)||(26789596-26789823)
chr7 (24-231)||(26795523-26795733)
chr7 (9-218)||(26805401-26805613)
chr7 (76-231)||(26824629-26824772)
chr7 (27-230)||(26800317-26800523)
chr7 (9-83)||(26824226-26824300)


Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 7)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 231
Target Start/End: Original strand, 26836099 - 26836323
Alignment:
7 ccaccaccataataggccctcaatattgtactccatatccggtggaactcgcggtggtgaaaaaggtgatgaccattgcagacaacttaaccgttactga 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26836099 ccaccaccataataggccctcaatattgtactccatatccggtggaactcgcggtggtgaaaaaggtgatgaccattgcagacaacttaaccgttactga 26836198  T
107 tatcaacggcaacatagtcttcaaagttaagggttctgtgtttaccatacgtgaccaccgtgtcttggttgatgcggccggtaaccctatcatcacccta 206  Q
    | |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
26836199 tgtcaacggcaacatagttttcaaagttaagggttctgtgtttaccatacgtgaccaccgtgtcttggttgatgcggccggtaaccccatcatcacccta 26836298  T
207 cgtcgcaaggtatgttcaactttat 231  Q
    |||||||||||||||||||||||||    
26836299 cgtcgcaaggtatgttcaactttat 26836323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 4 - 231
Target Start/End: Original strand, 26789596 - 26789823
Alignment:
4 ccaccaccaccataataggccctcaatattgtactccatatccggtggaactcgcggtggtgaaaaaggtgatgaccattgcagacaacttaaccgttac 103  Q
    |||||||||||||| | ||| ||||||||||| |||| || ||||||||  | ||||| ||||||||||| |||||||| ||||||||||| || ||||     
26789596 ccaccaccaccatattcggctctcaatattgtgctccttaaccggtggatttagcggttgtgaaaaaggtaatgaccatggcagacaacttcactgttaa 26789695  T
104 tgatatcaacggcaacatagtcttcaaagttaagggttctgtgtttaccatacgtgaccaccgtgtcttggttgatgcggccggtaaccctatcatcacc 203  Q
     ||| |||| |||||| | || || ||||| || |||||| | || ||| | ||||||| ||||||||||||||||||  |||||||||| |||| ||||    
26789696 agatgtcaatggcaacgtcgtgtttaaagtcaaaggttctctcttaaccctccgtgaccgccgtgtcttggttgatgcctccggtaaccccatcaccacc 26789795  T
204 ctacgtcgcaaggtatgttcaactttat 231  Q
    |||||||||||||||||| | |||||||    
26789796 ctacgtcgcaaggtatgtactactttat 26789823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 24 - 231
Target Start/End: Original strand, 26795523 - 26795733
Alignment:
24 cctcaatattgtactccatatccggtggaactcgcggtggtgaaaaaggtgatgaccattgcagac---aacttaaccgttactgatatcaacggcaaca 120  Q
    |||||||||||| |||| ||||||||||| || || |||||||||||||||||||||||| |||||   |||||  | ||||||||| |||||||||| |    
26795523 cctcaatattgtgctccgtatccggtggatcttgccgtggtgaaaaaggtgatgaccatttcagacggaaacttcgctgttactgatgtcaacggcaata 26795622  T
121 tagtcttcaaagttaagggttctgtgtttaccatacgtgaccaccgtgtcttggttgatgcggccggtaaccctatcatcaccctacgtcgcaaggtatg 220  Q
    | |||||||||||||| || ||| | || ||| | ||||| | |||||||||| ||||||| || |||||||| |||| |||||| ||||| |||||| |    
26795623 ttgtcttcaaagttaaaggctctctcttaaccctccgtgatcgccgtgtcttgcttgatgctgctggtaaccccatcaccaccctccgtcgtaaggtagg 26795722  T
221 ttcaactttat 231  Q
    ||| |||||||    
26795723 ttccactttat 26795733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 9 - 218
Target Start/End: Original strand, 26805401 - 26805613
Alignment:
9 accaccataataggccctcaatattgtactccatatccggtggaactcgcggtggtgaaaaaggtgatgaccattgcagac---aacttaaccgttactg 105  Q
    ||||||||| | ||||||||||||||| |||| |||||  ||||  | || ||||| |||||||||||  | ||| |||||   |||||   ||| || |    
26805401 accaccatatttggccctcaatattgtgctccgtatccattggatttggctgtggtcaaaaaggtgatagcaatttcagacggaaacttcgtcgtcaccg 26805500  T
106 atatcaacggcaacatagtcttcaaagttaagggttctgtgtttaccatacgtgaccaccgtgtcttggttgatgcggccggtaaccctatcatcaccct 205  Q
    || |||||||||| || |||||||||||||| | |||| | || ||| | ||||||| |||||||||||||||||| || | ||||||||||| ||||||    
26805501 atgtcaacggcaatattgtcttcaaagttaaagtttctcttttaaccttccgtgaccgccgtgtcttggttgatgccgcagataaccctatcaccaccct 26805600  T
206 acgtcgcaaggta 218  Q
    |||||||||||||    
26805601 acgtcgcaaggta 26805613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 76 - 231
Target Start/End: Original strand, 26824629 - 26824772
Alignment:
76 tgaccattgcagacaacttaaccgttactgatatcaacggcaacatagtcttcaaagttaagggttctgtgtttaccatacgtgaccaccgtgtcttggt 175  Q
    ||||||||||||||||||||||| |||||||| |||||| |||||| |||||||            |||| |||||| || |||| |||||| |||||||    
26824629 tgaccattgcagacaacttaaccattactgatgtcaacgacaacattgtcttca------------ctgtatttaccctaggtgatcaccgtctcttggt 26824716  T
176 tgatgcggccggtaaccctatcatcaccctacgtcgcaaggtatgttcaactttat 231  Q
    |||||| ||| | ||||| ||||||||||||||||| |||||||||||||||||||    
26824717 tgatgccgcccggaaccccatcatcaccctacgtcgtaaggtatgttcaactttat 26824772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 27 - 230
Target Start/End: Original strand, 26800317 - 26800523
Alignment:
27 caatattgtactccatatccggtggaactcgcggtggtgaaaaaggtgatgaccattgcagac---aacttaaccgttactgatatcaacggcaacatag 123  Q
    ||||||||| ||||||||||||||||  | || || ||||||||||| ||||||||| ||||    |||||  |||| |||||| ||||||||||||| |    
26800317 caatattgtgctccatatccggtggatttggctgtcgtgaaaaaggttatgaccatttcagatggaaactttgccgtcactgatgtcaacggcaacatcg 26800416  T
124 tcttcaaagttaagggttctgtgtttaccatacgtgaccaccgtgtcttggttgatgcggccggtaaccctatcatcaccctacgtcgcaaggtatgttc 223  Q
    | |||||||| || |||||| | || ||| | ||||||| |||||||||||||||||| || ||| |||| |||   ||| | ||||||||||||| |||    
26800417 tgttcaaagtaaaaggttctctcttaaccctccgtgaccgccgtgtcttggttgatgccgctggttaccccatcgcaaccttgcgtcgcaaggtatcttc 26800516  T
224 aacttta 230  Q
    || ||||    
26800517 aatttta 26800523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 9 - 83
Target Start/End: Original strand, 26824226 - 26824300
Alignment:
9 accaccataataggccctcaatattgtactccatatccggtggaactcgcggtggtgaaaaaggtgatgaccatt 83  Q
    |||||||||||| ||||||||||||||  ||| ||||||||| |  | || || |||||||||||||||||||||    
26824226 accaccataatatgccctcaatattgtgatccgtatccggtgaatttggccgtagtgaaaaaggtgatgaccatt 26824300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University