View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3388_low_34 (Length: 242)
Name: NF3388_low_34
Description: NF3388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3388_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 35806467 - 35806678
Alignment:
| Q |
1 |
tagtggataacatttgtactaatactcccatatttttgcattgttctagaataattggtggtccagaaatactctctcagaagttgaatataaaatgatt |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35806467 |
tagtggataacatttgtactgatactcccagatttttgcattgttctagaataattggtggtccagaaatactctctcagaagttgaatataaaatgatt |
35806566 |
T |
 |
| Q |
101 |
tgaatatataatcaaatttaactgtcactatatttgctgttatctcccaaatcactgtatgtttgattttcaaatgacttgttttgttcttatggaacaa |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35806567 |
tgaatatataaccaaatttaactgtcactatatttgctgttatctcccaaatcactgtatgtttgattttcaaatgacttgttttgttcttatggaacaa |
35806666 |
T |
 |
| Q |
201 |
attcttgtgagt |
212 |
Q |
| |
|
||||||||||| |
|
|
| T |
35806667 |
gttcttgtgagt |
35806678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University