View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3391_high_21 (Length: 242)
Name: NF3391_high_21
Description: NF3391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3391_high_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 41379356 - 41379130
Alignment:
| Q |
1 |
gtttctaacgaattaggtgatacctagagaaaccaaaacacatattttgctttggtataannnnnnnccagatgctggtttattatgcctagagaaacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
41379356 |
gtttctaacgaattaggtgatacctagagaaaccaaaacacatattttgctttggtataatttttttccagatgctggtttattatgcctagggaaacca |
41379257 |
T |
 |
| Q |
101 |
aaaccatcccaaagttccttcatcccaaagtttgtctcccatattttgcttttaaag-nnnnnnnnagtgaacagctttgtaaacaacatttaatcttgt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
41379256 |
aaaccatcccaaagttccttcatcccaaagtttgtctcccatattttgctttttaagtttttttttagtgaacagctttgcaaacaacatttaatcttgt |
41379157 |
T |
 |
| Q |
200 |
gtcagctgcattttgctaactacaaac |
226 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
41379156 |
gtcagctgcattttgctaactacaaac |
41379130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University