View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3391_high_25 (Length: 240)
Name: NF3391_high_25
Description: NF3391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3391_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 15148047 - 15148146
Alignment:
| Q |
1 |
ttccatgatcctcttcgtttcttttattttattgtgaaaactcataaccctaatcaagactaagtgtttgagcttgactaatcaagagattgatatcagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15148047 |
ttccatgatcctcttcgtttcttttattttattgtgaaaactcataaccctaattaagacgaagtgtttgagcttgactaatca--agattgatatcagc |
15148144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 156 - 222
Target Start/End: Original strand, 15148200 - 15148266
Alignment:
| Q |
156 |
tgattattataatttgcagtcttagacaattactttgttgaaagatagagatgttcctagaaatata |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15148200 |
tgattattataatttgcagtcttagacaattactttgttgaaagataaagatgttcctagaaatata |
15148266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University