View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3391_high_26 (Length: 237)
Name: NF3391_high_26
Description: NF3391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3391_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 7 - 222
Target Start/End: Original strand, 5980508 - 5980723
Alignment:
| Q |
7 |
agggtggtgttcctttttcttgtacaatattggattcctttagcttttcttgttctcttcacaaactccaacaatgtgaatctatcgagattagtattat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
5980508 |
agggtggtgttcctttttcttgtacaatattggattcctttaacttttcttgttctcttcacaaactccaacaatgtgaacccatcgagattagtattat |
5980607 |
T |
 |
| Q |
107 |
ttattttcaaagaaaaaagtggagatggtggatttggtaaaaagaatagaaagaattgagtggggttttagtattctttttcctatttaattttattgct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5980608 |
ttattttcaaagaaaaaagtggagatggtggatttggtaaaaagaatagaaagaattgagtggggttttagtattctttttcctatttaattttattgct |
5980707 |
T |
 |
| Q |
207 |
ttataagtgatgcttt |
222 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5980708 |
ttataagtgatgcttt |
5980723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University