View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3391_high_28 (Length: 213)
Name: NF3391_high_28
Description: NF3391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3391_high_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 199
Target Start/End: Complemental strand, 34059837 - 34059656
Alignment:
| Q |
18 |
cactcttgagccccatgaacatccttgaatgtttttatcttcattcatactgttttaacagcatgcttcactcgattaactattgttctgacttgaccca |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34059837 |
cactctcgagccccatgaacatccttgaatgtttttatcttcattcatactgttttaacagcatgcttcactggattaactattgttctgacttgaccca |
34059738 |
T |
|
| Q |
118 |
agtaaggaagcgccgaagcaaaaaagttatgatatcgaatcacaaagtgtggttttgcctgaaaatgtgagattgatctgtg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34059737 |
agtaaggaagcgccgaagcaaaaaagttgtgatatcgaatcacaaagtgtggttttgcctgaaaatgtgagattgatctgtg |
34059656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 37 - 188
Target Start/End: Original strand, 22232520 - 22232676
Alignment:
| Q |
37 |
catccttgaatgtttttatcttcattcatactgttttaacagcatgcttcactcgattaactattgttctgacttgacccaagtaaggaag---cgccga |
133 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||| |||| |||| |||| |||||||| || |||||| ||||||| || || |||||| |
|
|
| T |
22232520 |
catccttgaatgtttttatcttcattccaactgttttgacagcctgctccactggattcactattgtccttacttgatccaagtagggtagtgccgccga |
22232619 |
T |
|
| Q |
134 |
agcaaaaaag--ttatgatatcgaatcacaaagtgtggttttgcctgaaaatgtgag |
188 |
Q |
| |
|
|||| | ||| || |||||| |||| ||||||||||| ||| |||| |||| |||| |
|
|
| T |
22232620 |
agcagagaagttttgtgatattgaatgacaaagtgtggcttttcctggaaatatgag |
22232676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University