View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3391_low_11 (Length: 333)
Name: NF3391_low_11
Description: NF3391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3391_low_11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 19 - 333
Target Start/End: Complemental strand, 6725575 - 6725261
Alignment:
| Q |
19 |
ggtcatgtctgcacattatatattaatttgtttatgagaattgataaaacaagcacacaccgtatatttttgtaaggggaacacataccgtattccatgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6725575 |
ggtcatgtctgcacattatatattaatttgtttatgagaattgataaaacaagcacacaccgtatatttttgtaaggggaacacataccgtattccatgc |
6725476 |
T |
 |
| Q |
119 |
atgatcagtaatggcttgttattgcatacgttgtggcaaaacatgtgtccaaatatcaaccctctttgtttatatatatggtatttagaagaagcttgac |
218 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6725475 |
aagatcagtaatggcttgttattgcatacgttgtggcaaaacctgtgtccaaatatcaaccctctttgtttatatatatggtatttaggagaagcttgac |
6725376 |
T |
 |
| Q |
219 |
tagtcatggcaatttttatttgttgcaataatctttgtgttgatggtggttagagctatcggagtcggaagtacatctttttgtaacgtgtttgtttgtc |
318 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
| T |
6725375 |
tagtcatggcaatttttatttgttgtaataatctttgtgttgatggtggttagagctatcggagtcggaagtacatctttttgtaacatgtttgttggtc |
6725276 |
T |
 |
| Q |
319 |
gagtctattttattt |
333 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
6725275 |
gagtctatttgattt |
6725261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University