View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3392_low_14 (Length: 280)
Name: NF3392_low_14
Description: NF3392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3392_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 11 - 228
Target Start/End: Original strand, 4573807 - 4574024
Alignment:
| Q |
11 |
caaaggtaaagatagtgtgtggtgggttaatttgagatagagggtagagcttaatattgattcaagtgtggttgttaacacattgcgatatcaaactggc |
110 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4573807 |
caaaggtaaagatattgtgtggtgggttaatgtgagatagagggtagagcttaatattgattcaagtgtggttgttaacacattgcgatatcaaactggc |
4573906 |
T |
|
| Q |
111 |
gggagtagtttaggaggatggttcgtgcaatatgctttggttggtggagattgattgagaggtcaaaatttgtcattctcatgttgaaataaatcatcgt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
4573907 |
gggagtagtttaggaggatggttcgtgcaatatgctttggttggtggagatggatcgagaggtcaaaatttgtcattctcatgttgaaataaatcttcgt |
4574006 |
T |
|
| Q |
211 |
gttgatactttggcaaac |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4574007 |
gttgatactttggcaaac |
4574024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 219 - 260
Target Start/End: Original strand, 19655138 - 19655179
Alignment:
| Q |
219 |
tttggcaaacggaaaatacttgggtgatataaagttgggtga |
260 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
19655138 |
tttggcaaacggaaaatacttgggtgacatagagttgggtga |
19655179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 229 - 260
Target Start/End: Original strand, 53954609 - 53954640
Alignment:
| Q |
229 |
ggaaaatacttgggtgatataaagttgggtga |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
53954609 |
ggaaaatacttgggtgatataaagttgggtga |
53954640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 264
Target Start/End: Original strand, 6271690 - 6271727
Alignment:
| Q |
227 |
acggaaaatacttgggtgatataaagttgggtgatatt |
264 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
6271690 |
acggaaaatacttgggtgacatagagttgggtgatatt |
6271727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University