View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3392_low_19 (Length: 250)
Name: NF3392_low_19
Description: NF3392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3392_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 1601282 - 1601400
Alignment:
| Q |
1 |
ttgaagttcttaaacaagttgaaaatcaatttgttgtatatactgataaattaaatcttaggcta-tttttttnnnnnnnnnnntcttggctctatcaaa |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||||||||||||| |
|
|
| T |
1601282 |
ttgaagttcttaaacaagttgaaaatcaatttgttgtatatactgataaattaaatcttaagctattttttttttaaaaaaaaatcttggctctatcaaa |
1601381 |
T |
|
| Q |
100 |
tagaaatcaaatcaaattg |
118 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1601382 |
tagaaatcaaatcaaattg |
1601400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 162 - 213
Target Start/End: Original strand, 1601441 - 1601492
Alignment:
| Q |
162 |
atgatttgtccacacttccggtaactagatattagggttctctcttgtaacc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1601441 |
atgatttgtccacacttccggtaactagatattagggttctctcttgtaacc |
1601492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University