View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3392_low_24 (Length: 220)
Name: NF3392_low_24
Description: NF3392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3392_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 33526412 - 33526615
Alignment:
| Q |
1 |
ctctcaacactttaactctttcttgtcttgtctttttcttcttctactataacacaacacagtaatctc--attttttccaaaaatctcttccacacnnn |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33526412 |
ctctcaacactttaactctttcttgtcttgtctttttcttcttctactataacacaacacagtaatctctcattttttccaaaaatctcttccacacttt |
33526511 |
T |
 |
| Q |
99 |
nnnncatggcttccctcaatctccttcttcacccctcaacttctctctctcaccccctactaccattttcttcttcatgttcttgtttctttccaagaac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33526512 |
ttttcatggcttccctcaatctccttcttcacccctcaacttctctctctcaccccctactaccattttcttcttcatgttcttgtttctttccaagaac |
33526611 |
T |
 |
| Q |
199 |
caac |
202 |
Q |
| |
|
|||| |
|
|
| T |
33526612 |
caac |
33526615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University