View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3392_low_9 (Length: 348)
Name: NF3392_low_9
Description: NF3392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3392_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 20 - 329
Target Start/End: Complemental strand, 38466215 - 38465906
Alignment:
| Q |
20 |
gttgatagtgaggatgagaaggtagaacttgctgctactgccatggtgtttgtaaattgtaacgcaagtttagccagtgaaatcttatcctacgttagtt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466215 |
gttgatagtgaggatgagaaggtagaacttgctgctactgccatggtgtttgtaaattgtaacgcaagtttagccagtgaaatcttatcctacgttagtt |
38466116 |
T |
 |
| Q |
120 |
agggtatgggcctatgatttatgggctgaaaaatggtgtttcagcctaagcccagagaaaaatcgcaaaaaggttgctattaatcaaaggtcatgagttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466115 |
agggtatgggcctatgatttatgggctgaaaaatggtgtttcagcctaagcccagagaaaaatcgcaaaaaggttgctattaatcaaaggtcatgagttt |
38466016 |
T |
 |
| Q |
220 |
gaatcttgactcgagagactagtctctgcagttgtgtgcagagatactcagtacatacaaacaattataatatcttttgcatataatttttagattttac |
319 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38466015 |
gaatctcgactcgagagactagtctctgcagttgtgtgcagagatactcagttcatacaaaaaattataatatcttttgcatataatttttagattttac |
38465916 |
T |
 |
| Q |
320 |
acaatattta |
329 |
Q |
| |
|
|||||||||| |
|
|
| T |
38465915 |
acaatattta |
38465906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University