View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3393_high_11 (Length: 282)
Name: NF3393_high_11
Description: NF3393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3393_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 18 - 268
Target Start/End: Complemental strand, 39679714 - 39679464
Alignment:
| Q |
18 |
cattatagtattaaaatgttcgtcttctcgaaggagtggtaagtattttgcaaccgcgagtggcgcactttgatcaaaacggatttgatctttccaccat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39679714 |
cattatagtattaaaatgttcgtcttctcgaaggagtggtaagtattttgcaaccgcgagtggcgcgctttgatcaaaacggatttgatctttccaccat |
39679615 |
T |
|
| Q |
118 |
tcgcgtaaactatcagacgaacctgataccggtttacccttttcagggatgattccatagacaaaacctttggctttgcatacatccatgatctttgcca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39679614 |
tcgcgtaaactatcagacgaacctgataccggtttacccttttcagggatgattccatagacaaaacctttggctttgcatacatccatgatctttgcca |
39679515 |
T |
|
| Q |
218 |
tgtatttgagtactgaatcttgtgctcttgacatctttttccttcttgatg |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39679514 |
tgtatttgagtactgaatcttgtgctcttgacatctttttccttcttgatg |
39679464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 106 - 268
Target Start/End: Complemental strand, 38052169 - 38052007
Alignment:
| Q |
106 |
tctttccaccattcgcgtaaactatcagacgaacctgataccggtttacccttttcagggatgattccatagacaaaacctttggctttgcatacatcca |
205 |
Q |
| |
|
|||||||||||||| || || || || || ||||||| ||| ||||| || || || || | || |||||||||||||||| |||||||||| || |
|
|
| T |
38052169 |
tctttccaccattcacgcaagctttctgaagaacctgttactggttttcctttctctggaacaataccatagacaaaaccttgagctttgcatattgtca |
38052070 |
T |
|
| Q |
206 |
tgatctttgccatgtatttgagtactgaatcttgtgctcttgacatctttttccttcttgatg |
268 |
Q |
| |
|
| ||||| |||||||||||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38052069 |
taatcttcatcatgtatttgagaattgaatcttgtgctcttgacatctttttccttcttgatg |
38052007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University