View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3393_low_15 (Length: 237)

Name: NF3393_low_15
Description: NF3393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3393_low_15
NF3393_low_15
[»] chr8 (2 HSPs)
chr8 (1-161)||(30055385-30055542)
chr8 (184-221)||(30055817-30055854)


Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 30055385 - 30055542
Alignment:
1 atcgatcgagagtagcagaatgaatgataaggtcactgttcttggaactaataataatccggtttctctgcacttaaaccggttctaagaccggaacaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||    
30055385 atcgatcgagagtagcagaatgaatgataaggtcactgttcttggaactaat---aatccggtttctctgcacttaaaccggttctaagaccggaacaac 30055481  T
101 aggatgaatatgtgtttcctttcttgttttttggtcgaaattgacaccatgtatgtttttt 161  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30055482 aggatgtatatgtgtttcctttcttgttttttggtcgaaattgacaccatgtatgtttttt 30055542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 184 - 221
Target Start/End: Original strand, 30055817 - 30055854
Alignment:
184 gatgttttttcagagaatcttttaccaactaatatatc 221  Q
    ||||||||||||||||||||||||||||||||||||||    
30055817 gatgttttttcagagaatcttttaccaactaatatatc 30055854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University