View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3393_low_15 (Length: 237)
Name: NF3393_low_15
Description: NF3393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3393_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 161
Target Start/End: Original strand, 30055385 - 30055542
Alignment:
| Q |
1 |
atcgatcgagagtagcagaatgaatgataaggtcactgttcttggaactaataataatccggtttctctgcacttaaaccggttctaagaccggaacaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30055385 |
atcgatcgagagtagcagaatgaatgataaggtcactgttcttggaactaat---aatccggtttctctgcacttaaaccggttctaagaccggaacaac |
30055481 |
T |
 |
| Q |
101 |
aggatgaatatgtgtttcctttcttgttttttggtcgaaattgacaccatgtatgtttttt |
161 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30055482 |
aggatgtatatgtgtttcctttcttgttttttggtcgaaattgacaccatgtatgtttttt |
30055542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 184 - 221
Target Start/End: Original strand, 30055817 - 30055854
Alignment:
| Q |
184 |
gatgttttttcagagaatcttttaccaactaatatatc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30055817 |
gatgttttttcagagaatcttttaccaactaatatatc |
30055854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University