View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3393_low_19 (Length: 227)
Name: NF3393_low_19
Description: NF3393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3393_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 3724800 - 3725021
Alignment:
| Q |
1 |
aagtgtagaaatatacatcaaatatattcctgttttcttacacctcattggaacaaaacttttaagattgttagatatttgaggaggagctaaatagaag |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
3724800 |
aagtgtagaactatacatcaaatatattcctgttttcttacacctcattggaacaaaacttttaagattgttggatatttgaggaggagctaaataaaag |
3724899 |
T |
 |
| Q |
101 |
tctatcatgggatgggagagaaatgcatagaaaaaataagacatgagttgaaatttgactaatacacttactagattaagattacaaccatctgagttta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3724900 |
tctatcatgggatgggagagaaatgcatagcaaaaatacgacatgagttaaaatttgactaatacacttactagattaagattacaaccatctgagttta |
3724999 |
T |
 |
| Q |
201 |
attttattgggttcttctctct |
222 |
Q |
| |
|
|||||||||| ||| ||||||| |
|
|
| T |
3725000 |
attttattggtttcatctctct |
3725021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University