View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3394_high_4 (Length: 380)
Name: NF3394_high_4
Description: NF3394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3394_high_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 1e-47; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 242 - 354
Target Start/End: Complemental strand, 32270620 - 32270508
Alignment:
| Q |
242 |
gagattctttccactttttaaagttgtccctttgtgttgaaacttcttttttaatcattcaagatcaagtacttcttctttttcaaacctttgtttttaa |
341 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
32270620 |
gagactctttccacttcttaaagttgtccctttgtgttgaaacttcttttttaatcattcaagatcaagtacttcttctttttcaatcctttgcttttaa |
32270521 |
T |
|
| Q |
342 |
ttattgaatagtt |
354 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32270520 |
ttattgaatagtt |
32270508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 58 - 163
Target Start/End: Complemental strand, 32270797 - 32270692
Alignment:
| Q |
58 |
tatcatatcattctctcttatcttttaatctttttaggtgtatatacactcatataggggtatatcaaacatcttactgtaattatgatgcaggaggtag |
157 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
32270797 |
tatcatatcattctctcttatctattaatctttttaggtgtatatacactcagataggcgtatatcaaacatcttattgtaattatgctgcaggaggtag |
32270698 |
T |
|
| Q |
158 |
ctgtat |
163 |
Q |
| |
|
| |||| |
|
|
| T |
32270697 |
ccgtat |
32270692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 156 - 212
Target Start/End: Complemental strand, 32270674 - 32270618
Alignment:
| Q |
156 |
agctgtatgattttgaaagagcaaatttgcaaagaaacaaagataaagtgttatgag |
212 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32270674 |
agctgtatgattttgaaagagcaaatatgcaaagaaacaaagataaagtgttatgag |
32270618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 51
Target Start/End: Complemental strand, 32271394 - 32271361
Alignment:
| Q |
18 |
tatcatggcccctacgcaaggatgacacgcacaa |
51 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
32271394 |
tatcatggcccctgcgcaaggatgacacgcacaa |
32271361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 228 - 289
Target Start/End: Original strand, 12887699 - 12887759
Alignment:
| Q |
228 |
aaatggaaaacatagagattctttccactttttaaagttgtccctttgtgttgaaacttctt |
289 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||| | ||||||||| |||||||| |
|
|
| T |
12887699 |
aaatggaaaacatagagattctttcaacttattaaagttgt-cttttgtgttggaacttctt |
12887759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University