View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3394_high_6 (Length: 338)
Name: NF3394_high_6
Description: NF3394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3394_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 81 - 250
Target Start/End: Original strand, 31410672 - 31410831
Alignment:
| Q |
81 |
gtaaaattgatgataagatatttttgtttcccataaaataaaatattgtttgatctcaaattaacgtttggtatcactaattcacactaaaattatgtaa |
180 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| ||| || | | | ||||||| ||| | |
|
|
| T |
31410672 |
gtaaaattgatgataagatatttttatttcccataaaaaaaaatattgtttgatctcaaattaactattgata--------ttatattaaaattgtgt-a |
31410762 |
T |
 |
| Q |
181 |
acttagacgacaatctatcgtgatttgcatattatttaaattgtgtaaatttgaacgacaatccatctcg |
250 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31410763 |
acttagacgacaatctatcgcgatttgaatattatttaaattgtgtaaa-ttgaacgacaatccatctcg |
31410831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 9 - 90
Target Start/End: Original strand, 31409233 - 31409314
Alignment:
| Q |
9 |
agcacagaaaattagagaattggatggtttggattgaatttcataccacaacgatggagattgtttcattgtgtaaaattga |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31409233 |
agcacagaaaattagagaattggatggtttggattgaatttcataccacaacaatggagattgtttcattgtgtaaaattga |
31409314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University