View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3394_low_5 (Length: 373)
Name: NF3394_low_5
Description: NF3394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3394_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 24771401 - 24771647
Alignment:
| Q |
1 |
ccacaaattcatttcaacccactttgaggcaaaggcttataacagtaatttacnnnnnnntcgcccactggcatagccttatcagatgcaaatgagaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24771401 |
ccacaaattcatttcaacccactttgaggcaaaggcttataacagtaatttacaaaaaaatcgcccactggcatagccttatcagatgcaaatgagaaat |
24771500 |
T |
 |
| Q |
101 |
tgaagggaaatgccttaaaactaacaacaaataggcatgacacgttagagagtatgaatcgtgagaccacctgctcgttttccttgaccatggaaagcgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24771501 |
tgaagggaaatgccttaaaactaacaacaaataggcatgacacgttagagagtatgaatcgtgagaccacctgctcgttttccttgaccatggaaagcgc |
24771600 |
T |
 |
| Q |
201 |
cgatcggtaccaaatctagtgtgtcccctatactgcaaactaggacc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24771601 |
cgatcggtaccaaatctagtgtgtcccctatactgcaaactaggacc |
24771647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 298 - 358
Target Start/End: Original strand, 24771698 - 24771758
Alignment:
| Q |
298 |
ggcatcctcacgttttcatataatctttcttcagttttagccagtttcgttcggaaggttg |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24771698 |
ggcatcctcacgttttcatataatctttcttcagttttagccagttccgttcggaaggttg |
24771758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 239
Target Start/End: Complemental strand, 21003906 - 21003853
Alignment:
| Q |
186 |
gaccatggaaagcgccgatcggtaccaaatctagtgtgtcccctatactgcaaa |
239 |
Q |
| |
|
||||||||||||| || || |||||||||||||||| ||||||||||||||||| |
|
|
| T |
21003906 |
gaccatggaaagcaccaataggtaccaaatctagtgagtcccctatactgcaaa |
21003853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 239
Target Start/End: Complemental strand, 20993902 - 20993849
Alignment:
| Q |
186 |
gaccatggaaagcgccgatcggtaccaaatctagtgtgtcccctatactgcaaa |
239 |
Q |
| |
|
||||||||||||| || || |||||||||||||| | |||||||| |||||||| |
|
|
| T |
20993902 |
gaccatggaaagcaccaataggtaccaaatctagggagtcccctaaactgcaaa |
20993849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University