View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3394_low_7 (Length: 311)
Name: NF3394_low_7
Description: NF3394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3394_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 31411026 - 31411290
Alignment:
| Q |
1 |
cgcatgagggacacatgcacattaaatagaaatcaagtatctgcatagaaaattagtgaattggatggattggaattgaatttcataaagctcatatttg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31411026 |
cgcatgagggacacatgcacattaaatagaaatcaagtatctgcatagaaaattagtgaattggatggattggaattgaatttcataaagctcgtatttg |
31411125 |
T |
 |
| Q |
101 |
ttcgatctagatttacgatggagtaataaaatttgtttcttcaatctcaaataaatggttgatattaactacaacttaaaattgtgtagacttgaacgac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| || |
|
|
| T |
31411126 |
ttcgatctagatttacgatggagtaataaaatttgtttcttcaatctcaaataaatggttgatattaactacagcttaaaattgcgtagacttgaacaac |
31411225 |
T |
 |
| Q |
201 |
aatctattgcgtgattcaaaaattatttactcatgcatcgc--atattaagtgtgtaatatcttc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
31411226 |
aatctattgcgtgattcaaaaattatttactcatgtatcgcatatatcaagtgtgtaatatcttc |
31411290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University