View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3394_low_9 (Length: 256)
Name: NF3394_low_9
Description: NF3394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3394_low_9 |
 | |
|
| [»] scaffold1519 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold1519 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: scaffold1519
Description:
Target: scaffold1519; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 17 - 178
Target Start/End: Original strand, 97 - 258
Alignment:
| Q |
17 |
atttcgtacagtttgcaactgccttcaacagaaagacaaatgtaaccaactgatgagctggcatacaaatggaagtgtaactaactgcaaagctggcaga |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
97 |
atttcgtacagtttgcaactgccttcaacagaaagacaactgtaaccaactgatgagctggcatacaaatgggagtgtaactaactgcaaagctggcaga |
196 |
T |
|
| Q |
117 |
aatacaatattaacgagtttaagtactctatagaccttatccttccccccacaaactcaggg |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
197 |
aatacaatattaacgagtttaagtactctatagaccttatccttccccccacaaactcaggg |
258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1519; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 175 - 243
Target Start/End: Original strand, 365 - 433
Alignment:
| Q |
175 |
agggacataggaaacaattaaggacttgctaagaaccttttctcccacaaagaaaatgttcagttacct |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
365 |
agggacataggaaacaattaaggacttgctaagaaccctttctcccacaaagaaaatgttcagttacct |
433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University